Dysfunkcyjne oddziaływanie C / EBP i receptora glukokortykoidów w komórkach mięśni gładkich oskrzeli cd

Proliferację komórek oceniano po trzech i pięciu dniach leczenia 5% płodową surowicą cielęcą; komórki przemyto dwukrotnie chłodzoną lodem solą fizjologiczną buforowaną fosforanem, a następnie potraktowano trypsyną i EDTA (odpowiednio mM i 0,05 procent) przez jedną minutę. Roztwór trypsyny usunięto, a komórki ponownie zawieszono w 0,5 ml soli fizjologicznej buforowanej fosforanem. Komórki zawarte w 0,01 ml soli fizjologicznej buforowanej fosforanem zliczono w dwóch powtórzeniach dla każdej studzienki za pomocą ulepszonego hemocytometru Neubauera. Włączenie [3H] tymidyny zmierzono zgodnie ze standardowymi protokołami. Komórki przygotowano tak, jak były dla zliczeń komórek, ale hodowano je tylko przez 24 godziny po stymulacji i dodaniu 5 .Ci [3H] tymidyny na mililitr w ciągu ostatnich 6 godzin hodowli. Inkorporacja tymidyny została wyznaczona przez scyntylację cieczy, zliczanie przeprowadzono w trzech powtórzeniach.25,26,228
Leczenie
Mifepriston (10-7 lub 10-6 M) zastosowano w celu hamowania odpowiedzi komórek zależnych od receptora glukokortykoidowego. Sulfonowany antysensowny oligonukleotyd C / EBP. (5 G-AAGGCCGCGGCGCTGCTGGGCGCGT3 , MWG Biotech) zastosowano do obniżenia poziomu białka C / EBP., 17, 18, 25 i zastosowano zaszyfrowany sulfonowany oligonukleotyd (5 AGCTCGGATGCATGGAGGAG3 , MWG Biotech) jako kontrola negatywna.
Wektor ekspresji C / EBP.
Wektor ekspresyjny C / EBP. skonstruowano z całkowitego RNA ludzkich limfocytów krwi obwodowej za pomocą RNeasy (Qiagen). Jeden mikrogram całkowitego RNA poddano odwrotnej transkrypcji za pomocą SuperScript II (Invitrogen), a całą sekwencję kodującą C / EBP. zamplifikowano za pomocą enzymu polimerazy Pfx (Invitrogen) za pomocą reakcji łańcuchowej polimerazy (PCR) w następujących warunkach: : po denaturacji w temperaturze 98 ° C przez 2 minuty następowało 55 cykli denaturacji w temperaturze 98 ° C przez 30 sekund, hybrydyzacji w temperaturze 61 ° C przez 30 sekund, wydłużenia w temperaturze 68 ° C przez 100 sekund i wydłużenia w temperaturze 68 ° C 7 minut. Startery C / EBPa były 5 CACCATGGAGTCGGCCGACTTCT3 i 3 TCACGCGCAGTTGCCCATG5 . Po elektroforezie na 5% żelu agarozowym, pasmo DNA C / EBP. wyizolowano za pomocą ekstraktu NucleoSpin (Macherey-Nagel) i sklonowano w wektorze pvDNA3.1D / V5-His6-TOPO (Invitrogen) przez zmieszanie 4 .l ekstraktu DNA CEBP. z .l roztworu soli (1,2 M chlorek sodu i 0,06 M chlorek magnezu) i .l wektora TOPO. Mieszaninę inkubowano przez pięć minut w temperaturze pokojowej i 2 .l wektora C / EBP. transfekowano do Escherichia coli. Sukces transfekcji potwierdzono na podstawie odpowiedzi na ampicylinę. Transfekowane komórki oceniano pod kątem DNA C / EBP., które zsekwencjonowano za pomocą automatycznego sekwencera (MWG Biotech).
Komórki przejściowo transfekowano wektorem ekspresyjnym C / EBP. lub zielonym białkiem fluorescencyjnym przez godzinę w pożywce bez surowicy zawierającej 1,0 ng wektora na mikrolitr w odczynniku Tfx50 (Promega) (stosunek Tfx50 do DNA, 3: 1). . Transfekowane komórki inkubowano następnie w pożywce wzrostowej przez 24 godziny w obecności lub nieobecności leków. Szybkość transfekcji mierzono przejściowo transfekowanymi komórkami mięśni gładkich oskrzeli za pomocą wektora fluorescencyjnego białka zielonego – to jest wektora napędzanego promotorem cytomegalowirusa – naskórkowego czynnika wzrostu (p-d2EGFP-N1, Clontech)
[więcej w: polyporus, ceftriakson, anakinra ]
[hasła pokrewne: tęgoryjec objawy, fibrynoliza, olejek pichtowy zastosowanie ]