Utrata Smad3 w ostrej białaczce limfoblastycznej z limfocytów T cd

Związane z cykliną D3 kompleksy immunologiczne przemyto trzykrotnie 500 .l buforu RIPA i osad ponownie zawieszono w 30 .l buforu ładującego żel, a następnie ogrzewano w 95 ° C przez pięć minut w celu usunięcia związanych białek z kulek agarozowych. Kompleksy immunologiczne p27Kip1 traktowano w podobny sposób. Obie związane z cykliną D3 i wolne frakcje p27Kip1 rozdzielono za pomocą elektroforezy w żelu z dodecylosiarczanem sodu / poliakryloamidem na żelu TRIS-Glycine Novex (4 do 20 procent), przeniesiono na nitrocelulozę i inkubowano przez noc w 4 ° C z królicze przeciwciało poliklonalne przeciwko ludzkiemu p27Kip1 (sc-528, Santa Cruz Biotech) w rozcieńczeniu 1: 500 w soli fizjologicznej buforowanej TRIS zawierającej 4% mleka beztłuszczowego. Przeciwgrzybicze IgG osy skoniugowane z peroksydazą chrzanową (Amersham) stosowano do wykrywania związanego przeciwciała przeciw p27Kip1 za pomocą chemiluminescencji (system Pierce Super Signal West Pico). Analiza RNA Smad3 Messenger
RNA oczyszczono z próbek komórek białaczki i świeżo izolowanych prawidłowych komórek T krwi obwodowej przy użyciu odczynnika Trizol (Invitrogen) i wszelkie zanieczyszczające genomowe DNA usunięto przez trawienie DNazą RQ1 (Promega). Test odwrotnej transkrypcji-reakcji łańcuchowej polimerazy (RT-PCR) przeprowadzono z zastosowaniem jednoetapowego systemu RT-PCR Invitrogen s SuperScript III z platynową polimeremazą Taq DNA zgodnie z instrukcjami producenta; Zastosowano 700 ng RNA. Temperatura wygrzewania wynosiła 56 ° C. Przeprowadzono również PCR w nieobecności odwrotnej transkrypcji i włączono 700 ng RNA, Platinum Taq Supermix (Invitrogen) i Smad3 primers. Tożsamość produktu RT-PCR potwierdzono jako Smad3 przez bezpośrednie sekwencjonowanie oczyszczonego na żelu DNA. Następujące startery zastosowano do RT-PCR ludzkiego informacyjnego mysiego RNA Smad3 (mRNA): 5 Accatccccaggtccctggatggcc3 (starter do przodu) i 5 Aactcggccgggatctctgtgtggcgt3 (starter odwrotny); wielkość produktu PCR wynosi 253 pz. Ludzkie startery PCR dla .-aktyny zakupiono od R & D Systems (para primerów RDP-38-025); produkt PCR ma 528 bp.
Sekwencjonowanie genu MADH3
W celu przygotowania genomowego DNA, komórki białaczki trawiono w 300 .l buforu do lizy (200 mM chlorek sodu, 40 mM TRIS, pH 8,0, 20 mM EDTA, 0,5 procent dodecylosiarczanu sodu, 0,5 procent .-merkaptoetanolu i 2 mg świeżej proteinazy K na mililitr), a DNA wytrącono z lizatów przez dodanie 600 .l lodowatego etanolu, a następnie przepłukano i rozpuszczono w wodzie. Następujące startery zastosowano do amplifikacji PCR i sekwencjonowania ludzkich egzonów MADH3: ekson 1, 5 CGAAGTTTGGGCGACCGCGG3 (do przodu) i 5 CTCTCTCCCTCTTCCCATCTCCAGC3 (odwrotnie), uzyskując fragment PCR o 420 bp; ekson 2, 5 Caatcacatttccctctctttctg3 (do przodu) i 5 Cagcatacctggtgctctctac3 (do tyłu), otrzymując fragment o wielkości 246 bp; ekson 3, 5 Gtctttgcaaaaggtgtctc3 (do przodu) i 5 Ctgctaatcagttaagaataag3 (do tyłu), otrzymując produkt o 190 bp; ekson 4, 5 Caggccaagaatcttttgtgaag3 (do przodu) i 5Aaacctggcatatggttgtctttc3 (do tyłu), otrzymując produkt o 319 bp; ekson 5, 5 Gagattataatccctctgaaatgc3 (do przodu) i 5 Ctgcattcctgttgacattg3 (do tyłu), otrzymując produkt o 305 bp; ekson 6, 5 Cattgtgtgtgagcaaag3 (do przodu) i 5 Cacctccagattgacaacgcaatc3 (do tyłu), otrzymując produkt o 315 bp; ekson 7, 5 Ctgtttctgtgtttttggcag3 (do przodu) i Cttggcctctctctgatctttg3 (wsteczny), uzyskując produkt o 306 bp; ekson 8, 5 Agatgggttcaaggggagggactg3 (do przodu) i 5 Tttctgctcttgacgctagggctg3 (do tyłu), otrzymując produkt o wielkości 467 bp; i ekson 9, 5 GGTAGAGGAGTTTGGCCGGGTAGTT3 (do przodu) i 5 TGGGGCCAAAGGGTAAATGTGTT3 (do tyłu), dając produkt o 521 bp.
Proliferation Assays and Interleukin-2 Measurements
Splenocyty z myszy Smad3 + / +, Smad3 +/- i Smad3 – / – pozbawiono czerwonych krwinek za pomocą buforu do lizy ACK (Quality Biological) i wysiano na 5 x 104 komórek na studzienkę (płytka z 96 dołkami z okrągłym dnem) w końcowej objętości 200 .l pożywki kompletnej RPMI (RPMI uzupełnionej 10% inaktywowaną termicznie płodową surowicą cielęcą, 100 U penicyliny G na mililitr, 100 U streptomycyny na mililitr, 0,25 .g Fungizone na mililitr i 50 .M 2-merkaptoetanol
[więcej w: dronedaron, hurtownia portfeli, ceftriakson ]
[więcej w: oksydaza ksantynowa, xyzal opinie, psycholog dziecięcy piła ]